Grobblefruit Appreciation Society

First of all: I've just moved this blog to my own domain, now with significantly less suck: http://modernduck.com/blog/ - for those of you who want to follow my travel adventures in January, this is where they'll be.  For just the itineraries go here.

Secondly: those of you in Montréal who like plays MUST go see Altera Vitae's production of Bent.  Awesome.

The difference between dreams and plans is when you book a ticket :) I'm traveling in Asia next year!

Air travel booked so far:

Thu Dec 24, 20:50: AC  632, YUL-YYT, arr  0:47 Dec 25.  With Robin and Aslan.
Wed Dec 30,  7:00: AC 1197, YYT-YYZ, arr  9:15.  Robin's heading back to Montréal around the same time.
Wed Dec 30, 12:00: AC    1, YYZ-NRT, arr 15:05 Dec 31

The plan from there: spend ~2 months in Japan with an apartment in Tokyo but traveling all around (Honshu anyway.) Robin will arrive sometime in mid-February so we'll do some of this together.

Then: fly NRT-SIN and head north overland. Climbing in Krabi/Railay. Visit Laos and Cambodia, but spend most of our time in Thailand and Vietnam. Arrive in China late April/early May and explore there.

Take the train to Lhasa in mid May, possibly alone or maybe this will be the last part of the trip with Robin. Mountain bike Lhasa -> Kathmandu. Fly back to China, train/fly to Beijing.

Around June 20: take the Trans-Mongolian & Trans-Siberian to Moscow/St-Petersburg, hopefully with Clare and Dad. Take another train somewhere that has direct flights to Montréal (AMS?). Fly home late July / early August.

Then... who knows? Probably drive to Burning Man :)

PS Anyone want to rent a plateau 5½ for $1125/month starting in January?

I'm selling all my camera gear because I basically never use it. This is for friends only, local pickup in Montréal (delivery to Ottawa or Toronto may be possible.) Whatever doesn't sell is going on eBay where I can get slightly more than the prices I've listed, so these are NOT negotiable.
( Collapse )

If you missed it at fringe, or (like me) saw it at fringe and need to see it again, Teen Sleuth and the Freed Cyborg Choir is playing Wednesday -> Funday at MainLine Theatre.

I'm going on either Wednesday, Caturday, or Funday. Let me know if you want to join in!

This is a long shot, but does anyone know where I can get a DNA sequence from a cat - any cat? I don't even need the whole thing - 100 base pairs should be enough. It's for an art project.

Update: Found!

tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga

Yeah, it looks like any other DNA sequence from any other animal... but I'll know :)

Boulder for work (and hopefully climbing):

Sun Jul 26, 19:00: QK 7694, YUL-IAD, arr 20:44
Sun Jul 26, 21:55: UA  933, IAD-DEN, arr 23:41
Mon Aug  3, 11:05: AC 1072, DEN-YUL, arr 16:37

Burning man!!!

Tue Aug 25,  9:45: AC 761, YUL-SFO, arr 12:52
Wed Sep  9, 13:15: AC 587, SFO-YYC, arr 16:49
Wed Sep  9, 17:50: AC 186, YYC-YUL, arr 23:47

My Fringe List: shows I definitely want to see, plus shows I've seen that you definitely need to see. May be updated throughout the week, or not.

"Anyway," Dave said. "I had a better idea."
"Different idea," said Morley.  "You had a different idea."

Buttersafe is so much win.

My birthday snuck up on me this year but I still want to do something. If you're free on Friday, come out for dinner! If not, no worries, I'll have a proper house party sometime this summer :)

PLEASE RSVP BY THURSDAY EVENING so I can reserve - here or on FB

Note: the restaurant is within walking distance to Saph's, though unfortunately I can't go this week.

Friday, May 29, 2009, 8:00pm - 11:00pm
Om Tibetan Restaurant, 4382 St Laurent