kitteh travel

...and so it begins.

The difference between dreams and plans is when you book a ticket :) I'm traveling in Asia next year!

Air travel booked so far:
Thu Dec 24, 20:50: AC  632, YUL-YYT, arr  0:47 Dec 25.  With Robin and Aslan.
Wed Dec 30,  7:00: AC 1197, YYT-YYZ, arr  9:15.  Robin's heading back to Montréal around the same time.
Wed Dec 30, 12:00: AC    1, YYZ-NRT, arr 15:05 Dec 31
The plan from there: spend ~2 months in Japan with an apartment in Tokyo but traveling all around (Honshu anyway.) Robin will arrive sometime in mid-February so we'll do some of this together.

Then: fly NRT-SIN and head north overland. Climbing in Krabi/Railay. Visit Laos and Cambodia, but spend most of our time in Thailand and Vietnam. Arrive in China late April/early May and explore there.

Take the train to Lhasa in mid May, possibly alone or maybe this will be the last part of the trip with Robin. Mountain bike Lhasa -> Kathmandu. Fly back to China, train/fly to Beijing.

Around June 20: take the Trans-Mongolian & Trans-Siberian to Moscow/St-Petersburg, hopefully with Clare and Dad. Take another train somewhere that has direct flights to Montréal (AMS?). Fly home late July / early August.

Then... who knows? Probably drive to Burning Man :)

PS Anyone want to rent a plateau 5½ for $1125/month starting in January?
sinfest, ponies

Camera gear for sale

I'm selling all my camera gear because I basically never use it. This is for friends only, local pickup in Montréal (delivery to Ottawa or Toronto may be possible.) Whatever doesn't sell is going on eBay where I can get slightly more than the prices I've listed, so these are NOT negotiable.
Collapse )
kitteh travel

Feline DNA sequence

This is a long shot, but does anyone know where I can get a DNA sequence from a cat - any cat? I don't even need the whole thing - 100 base pairs should be enough. It's for an art project.

Update: Found!

tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga

Yeah, it looks like any other DNA sequence from any other animal... but I'll know :)
kitteh travel

Boulder + BM

Boulder for work (and hopefully climbing):
Sun Jul 26, 19:00: QK 7694, YUL-IAD, arr 20:44
Sun Jul 26, 21:55: UA  933, IAD-DEN, arr 23:41
Mon Aug  3, 11:05: AC 1072, DEN-YUL, arr 16:37
Burning man!!!
Tue Aug 25,  9:45: AC 761, YUL-SFO, arr 12:52
Wed Sep  9, 13:15: AC 587, SFO-YYC, arr 16:49
Wed Sep  9, 17:50: AC 186, YYC-YUL, arr 23:47
sinfest, ponies

Last Minute Birthday Dinner

My birthday snuck up on me this year but I still want to do something. If you're free on Friday, come out for dinner! If not, no worries, I'll have a proper house party sometime this summer :)

PLEASE RSVP BY THURSDAY EVENING so I can reserve - here or on FB

Note: the restaurant is within walking distance to Saph's, though unfortunately I can't go this week.

Friday, May 29, 2009, 8:00pm - 11:00pm
Om Tibetan Restaurant, 4382 St Laurent