Grobblefruit Appreciation Society

moved; IMPORTANT PLAY RECOMMENDATION

lj@modernduck.com — Sat, 07 Nov 2009 13:40:24 GMT

First of all: I've just moved this blog to my own domain, now with significantly less suck: http://modernduck.com/blog/ - for those of you who want to follow my travel adventures in January, this is where they'll be. For just the itineraries go here.

Secondly: those of you in Montréal who like plays MUST go see Altera Vitae's production of Bent. Awesome.

...and so it begins.

lj@modernduck.com — Tue, 03 Nov 2009 00:26:59 GMT

The difference between dreams and plans is when you book a ticket :) I'm traveling in Asia next year!

Air travel booked so far:
Thu Dec 24, 20:50: AC 632, YUL-YYT, arr 0:47 Dec 25. With Robin and Aslan. Wed Dec 30, 7:00: AC 1197, YYT-YYZ, arr 9:15. Robin's heading back to Montréal around the same time. Wed Dec 30, 12:00: AC 1, YYZ-NRT, arr 15:05 Dec 31The plan from there: spend ~2 months in Japan with an apartment in Tokyo but traveling all around (Honshu anyway.) Robin will arrive sometime in mid-February so we'll do some of this together.

Then: fly NRT-SIN and head north overland. Climbing in Krabi/Railay. Visit Laos and Cambodia, but spend most of our time in Thailand and Vietnam. Arrive in China late April/early May and explore there.

Take the train to Lhasa in mid May, possibly alone or maybe this will be the last part of the trip with Robin. Mountain bike Lhasa -> Kathmandu. Fly back to China, train/fly to Beijing.

Around June 20: take the Trans-Mongolian & Trans-Siberian to Moscow/St-Petersburg, hopefully with Clare and Dad. Take another train somewhere that has direct flights to Montréal (AMS?). Fly home late July / early August.

Then... who knows? Probably drive to Burning Man :)

PS Anyone want to rent a plateau 5½ for $1125/month starting in January?

Camera gear for sale

lj@modernduck.com — Fri, 23 Oct 2009 03:07:34 GMT

I'm selling all my camera gear because I basically never use it. This is for friends only, local pickup in Montréal (delivery to Ottawa or Toronto may be possible.) Whatever doesn't sell is going on eBay where I can get slightly more than the prices I've listed, so these are NOT negotiable.

Nikon D200 10.2MP Digital SLR Camera Body Only $500
- Around 6000 shutter actuations (exact number TBD... if it's important, ask :)
- 2 batteries, both show 0 (new) in battery info ("charge life")
- 2 GB SanDisk Ultra II CF card
- minor cosmetic imperfections
Nikon MB-D200 Battery Grip for D200 or Fuji Finepix S5 $75
Nikon F100 35mm SLR Camera Body and MB-15 battery grip $150
- About 80 rolls
- Reprogrammed by Nikon for mid-roll rewind
- minor cosmetic imperfections
Nikon AF-S DX 18-200 3.5-5.6G ED IF VR Zoom Lens $500
- Excellent condition
- Always used with filter (Hoya Sky-B included)
Includes caps and hood
Tokina AF 12-24mm/F4 (IF) DX AT-X PRO Asph Lens for Nikon $400
- Excellent condition
- Includes caps and hood
Nikon 24-85/2.8-4 AF D-IF lens $300
- Excellent condition
- No hood ($35 new)
Nikon SB-80DX Speedlight TTL Flash $100
- Excellent condition
- Includes diffuser dome and bag
Nikon SB-600 Speedlight TTL Flash $150
- Excellent condition
- Includes case
FREE STUFF
- 50mm f/1.4 manual lens (Nikkor)
- 24mm f/2 manual lens (Vivitar, Nikon mount)
- 80-20mm f/4.5 manual lens (Sakar, Nikon mount)
- 58mm Sky-A filter (Tiffen)
- 58mm linear polarizer (Tiffen)
- 72mm circular polarizer (Tamron)
- Slik compact tripod, 8451T (30 to 70mm height, with pan & tilt head)

Teen Sleuth is back!

lj@modernduck.com — Tue, 29 Sep 2009 17:25:54 GMT

If you missed it at fringe, or (like me) saw it at fringe and need to see it again, Teen Sleuth and the Freed Cyborg Choir is playing Wednesday -> Funday at MainLine Theatre.

I'm going on either Wednesday, Caturday, or Funday. Let me know if you want to join in!

Feline DNA sequence

lj@modernduck.com — Sun, 26 Jul 2009 19:58:34 GMT

This is a long shot, but does anyone know where I can get a DNA sequence from a cat - any cat? I don't even need the whole thing - 100 base pairs should be enough. It's for an art project.

Update: Found!

tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga

Yeah, it looks like any other DNA sequence from any other animal... but I'll know :)

I'm in your city killing your dudes

lj@modernduck.com — Fri, 24 Jul 2009 15:10:34 GMT

We've all seen ads on the web that change depending on where they think you are: "Hot Montreal girls that want to fuck you now" or even "Hot Stittsville girls." I've never even been to Stittsville. Maybe I should go - apparently the girls are just as attractive as the girls here, and probably more desperate.

I'm somehow less convinced by this ad though:

Boulder + BM

lj@modernduck.com — Wed, 22 Jul 2009 17:51:23 GMT

Boulder for work (and hopefully climbing): Sun Jul 26, 19:00: QK 7694, YUL-IAD, arr 20:44 Sun Jul 26, 21:55: UA 933, IAD-DEN, arr 23:41 Mon Aug 3, 11:05: AC 1072, DEN-YUL, arr 16:37 Burning man!!! Tue Aug 25, 9:45: AC 761, YUL-SFO, arr 12:52 Wed Sep 9, 13:15: AC 587, SFO-YYC, arr 16:49 Wed Sep 9, 17:50: AC 186, YYC-YUL, arr 23:47

Fringe list

lj@modernduck.com — Sat, 13 Jun 2009 16:09:53 GMT

My Fringe List: shows I definitely want to see, plus shows I've seen that you definitely need to see. May be updated throughout the week, or not.

lj@modernduck.com — Fri, 12 Jun 2009 14:19:52 GMT

"Anyway," Dave said. "I had a better idea."
"Different idea," said Morley. "You had a different idea."

lj@modernduck.com — Thu, 11 Jun 2009 00:28:00 GMT

Buttersafe is so much win.

Last Minute Birthday Dinner

lj@modernduck.com — Wed, 27 May 2009 19:39:53 GMT

My birthday snuck up on me this year but I still want to do something. If you're free on Friday, come out for dinner! If not, no worries, I'll have a proper house party sometime this summer :)

PLEASE RSVP BY THURSDAY EVENING so I can reserve - here or on FB

Note: the restaurant is within walking distance to Saph's, though unfortunately I can't go this week.

Friday, May 29, 2009, 8:00pm - 11:00pm
Om Tibetan Restaurant, 4382 St Laurent

Don't go to Burning Man.

lj@modernduck.com — Fri, 08 May 2009 21:37:39 GMT

It's an addiction.

Next chance to get my fix: PDF.

Fri May 22, 17:49: US 3409, YUL-PHL, arr 19:35
Mon May 25, 20:45: US 3906, PHL-YUL, arr 22:23

For some reason, I thought Monday was a holiday in Canada as well but it's the Monday before. So I'm just going to drive to PHL fairly early and work from the lounge...

lj@modernduck.com — Sun, 26 Apr 2009 23:21:57 GMT

Wed Apr 29, 16:45: AC 8981, YUL-YOW, arr 17:24 Wed Apr 29, 18:40: AC 888, YOW-LHR, arr 6:25 Apr 30 Thu Apr 30, 8:50: BD 82, LHR-BHD, arr 10:10 Friday: Grandma's funeral. Died suddenly on Caturday.
Sun May 3, 8:50: BD 83, BHD-LHR, arr 10:15 Sun May 3, 15:30: AC 865, LHR-YUL, arr 17:50

Cody Rivers tonight?

lj@modernduck.com — Thu, 23 Apr 2009 12:12:14 GMT

I'm going to see Cody Rivers tonight at 20:00 at Mainline. They were at Fringe last year but this is a completely new show. Also, they're not at Fringe this year, so this is your chance.

Also playing Fri, Cat at 20:00... but I'm going tonight. Let me know if you want to join.

lj@modernduck.com — Mon, 20 Apr 2009 12:26:33 GMT

In the east there is a shark which is larger than all other fish. It changes into a bird whose wings are like clouds filling the sky. When this bird moves across the land, it brings a message from Corporate Headquarters. This message it drops into the midst of the programmers, like a seagull making its mark upon the beach. Then the bird mounts on the wind and, with the blue sky at its back, returns home.

The novice programmer stares in wonder at the bird, for he understands it not. The average programmer dreads the coming of the bird, for he fears its message. The master programmer continues to work at his terminal, for he does not know that the bird has come and gone.

- The Tao Of Programming

The return of Ceiling Cat

lj@modernduck.com — Mon, 13 Apr 2009 00:11:00 GMT

Ceiling Cat finally made it to Montréal from California on Caturday, December 20. I got up on Sunday the 21st and needed something to do as a distraction from the rest of my life. Then I spotted Him, still packed flat and wrapped up in an old bedsheet. There was to be a Solstice celebration that evening in NDG Park with lanterns. Perfect:

I spent all day building, then We rode out during the first blizzard of the winter and had fun solsticing.

Thanks to jbailey for getting him here from .ca.us and for taking the photo above!

Building-of photos here, including how he looked before folding.

Toronto itinerary

lj@modernduck.com — Wed, 01 Apr 2009 21:56:13 GMT

Fri Apr 17, 15:40: Via 65, Montréal-Toronto, arr 20:24 Sun Apr 19, 17:00: Via 66, Toronto-Montréal, arr 21:33

As I mentioned here before, I'm doing the CN Tower Climb, and you can still sponsor me if you like.

Party next weekend!

lj@modernduck.com — Sat, 21 Mar 2009 16:49:13 GMT

obskura is turning 11111 next Caturday, which is a good reason for a party :)

It's at my house on Caturday, March 28th. Let me know if you need the address or directions.

17:00-20:00: family friendly time, since a lot of you have kids now. Show up hungry if you like - we'll have plenty of food (and feel free to bring something to share.)

20:00-late: debauchery, Serious Drinking, etc.

BYOB or drink mine. It's all good :)

Note - there is a cat that lives here. Bring/take allergy meds if you need 'em.

Feel free to bring friends and wellwishers!

FB event is here.

apple++

lj@modernduck.com — Thu, 19 Mar 2009 21:53:30 GMT

Today, I got an Airport Express because I wanted to play music from my computer on the speakers in my bedroom (without dragging the computer in every time.) The complete setup process:

Took it out of the box, plugged it in.
Found the "Airport Setup Utility" already installed on my MacBook and ran it.
It disconnected me from my house wireless network and connected me to the new Airport (after warning me first.)
Answered a few easy questions. It automatically knew the name and password of my wireless network to connect to (staberinde and aslan if you're in the area and need wifi.)
It reconnected to my network.
Went into iTunes. Selected the new Airport from the speaker selector at the bottom of the window.

That's it. Can you imagine anything like that ever being so easy under Linux or Windows?

It's not perfect - there's a 33 character limit on the password that they didn't tell me about (normally, all my passwords are random 36 character strings because it's not like I have to memorize them anyway) - but all in all, Apple wins serious Just Works(tm) points on this one.

I think I'm a Montréaler now...

lj@modernduck.com — Thu, 19 Mar 2009 21:45:16 GMT

Last Caturday, walking back to obskura's after a party:

<scjody> I'm kinda hungry. Is there any good food around here that isn't Dad's?
<obskura> There's a pizza place up ahead.
<scjody> That sounds good. Is it the kind of place where I can get une pointe? Um, uh, I mean a slice. Couldn't remember the English word.

Advance warning: Robin's birthday

lj@modernduck.com — Sat, 07 Mar 2009 02:34:52 GMT

Robin and I are having a party on her birthday: March 28. If you read this, you're probably invited. Details and a proper invitation to follow :)

CN tower climb

lj@modernduck.com — Tue, 03 Mar 2009 01:33:56 GMT

I'm doing the CN tower stair climb this April 18... Let me know if you're interested in joining in. Infos here, and you can sponsor me by donating to the World Wrestling Federation if that's your kind of thing. (Tax receipts for donations of $20 or more.)

morning bright rise

lj@modernduck.com — Mon, 16 Feb 2009 17:41:41 GMT

"Morning."
"Good morning."
"Have you seen the coffee filters?"
"Corner cupboard."
"Did you see what Zoe did to the toilet roll?"
"Yeah, that dog can be bad."
"Morning."
"You've worked in a restaurant before?"
"Yeah, I figured I should warm up the coffee cups."
"Nice."
"Hey, man."
"Hey."
"Coffee?"
"Did you see the toilet roll?"
"Yeah. Zoe was bored."
"Why is there hot water in the coffee cups?"
"Warming them up. Just dump it out."
"Where are you skiing today?"
"Keystone."
"Breck."
"Vail."
"Nice."
"Morning."
"Thanks for letting us stay at your condo."
"No worries, have fun today."
"Want some coffee?"

"Time to go?"
"Yeah, I'm on the loading dock."
"Have a great day everyone!"

25 things

lj@modernduck.com — Fri, 06 Feb 2009 10:08:19 GMT

I've been enjoying reading everyone else's lists so I thought I'd do one of my own... I'm not going to "tag" anyone specific. If you haven't done one of these yet, stop slacking and get to it :)

21. I'm very logical, skeptical, and independent - maybe too much.
1. I wonder if that should count as 3 things? Nah, it's my list so I'll do what I want.
6. When I was 5, I wanted to be a plum when I grew up.
15. When I was 6, I wanted to be a swan when I grew up.
22. I still don't know what I want to be when I grow up.

25. I like variety more than anything. No matter how great something is, I need to change it now and then.
3. I have a white cat who spins in circles when he's excited or scared.
9. I believe all drugs should be legal and available to anyone who asks.
10. I biked across Canada in 2000 - all 10 000 km of it.
7. I can rarely _not_ finish a book/movie once I've started. Which is why I hate bad books :)

14. I don't understand people at all - often this includes myself.
5. I didn't own a TV until I had to spend 3 weeks recovering from surgery with not much else to do but watch movies. I still don't really like the thing.
8. If I had unlimited money, I'd buy a jet but probably not a car.
23. I have a love/hate relationship with caffeine and never stay addicted to it for too long at a time, or avoid it for too long either.
12. I've lived in the closest thing Kingston has to a frat house, above a crazy cat lady, and in a hippieish housing coop with a bike parking garage.

18. I try not to let material things (posessions, money) affect me. Sometimes I succeed.
11. I'm always torn between wanting to live in the middle of nowhere and the middle of a big city. So far the city is winning because of variety.
2. I think tattoos are great on other people, but I can't think of anything I want marked on me forever.
19. I also don't ever want kids but I'm happy that many of my awesome friends have been having awesome children lately.
17. I like building and fixing things. Often I'll build or fix something even when it would be better/cheaper to buy a new one.

13. I like public transit apart from buses. I think living in Ottawa killed buses for me.
4. I would, in fact, walk 500 miles.
24. I could easily work as a bike mechanic if I ever get sick of the computer industry.
20. I'd like to take a trip around the world (over at least a year) sometime. The question is when...
16. I randomized the numbers on these just to be different. That's how I roll.

Bouldering in Boulder

lj@modernduck.com — Thu, 05 Feb 2009 19:51:59 GMT

Sun Feb 8, 17:35: AC 8657, YUL-ORD, arr 19:04 Sun Feb 8, 20:08: UA 959, ORD-DEN, arr 21:49 Mon Feb 16, 11:25: AC 1072, DEN-YUL, arr 16:53 I don't actually mind Boulder anymore because I have a friend there who climbs and skis, and they have the best climbing gym I've ever seen.