|
Grobblefruit Appreciation Society
|
|
|
| ...and so it begins. |
[Nov. 2nd, 2009|07:07 pm] |
The difference between dreams and plans is when you book a ticket :) I'm traveling in Asia next year!
Air travel booked so far:
Thu Dec 24, 20:50: AC 632, YUL-YYT, arr 0:47 Dec 25. With Robin and Aslan.
Wed Dec 30, 7:00: AC 1197, YYT-YYZ, arr 9:15. Robin's heading back to Montréal around the same time.
Wed Dec 30, 12:00: AC 1, YYZ-NRT, arr 15:05 Dec 31 The plan from there: spend ~2 months in Japan with an apartment in Tokyo but traveling all around (Honshu anyway.) Robin will arrive sometime in mid-February so we'll do some of this together.
Then: fly NRT-SIN and head north overland. Climbing in Krabi/Railay. Visit Laos and Cambodia, but spend most of our time in Thailand and Vietnam. Arrive in China late April/early May and explore there.
Take the train to Lhasa in mid May, possibly alone or maybe this will be the last part of the trip with Robin. Mountain bike Lhasa -> Kathmandu. Fly back to China, train/fly to Beijing.
Around June 20: take the Trans-Mongolian & Trans-Siberian to Moscow/St-Petersburg, hopefully with Clare and Dad. Take another train somewhere that has direct flights to Montréal (AMS?). Fly home late July / early August.
Then... who knows? Probably drive to Burning Man :)
PS Anyone want to rent a plateau 5½ for $1125/month starting in January?
|
|
|
| Camera gear for sale |
[Oct. 22nd, 2009|10:59 pm] |
I'm selling all my camera gear because I basically never use it. This is for friends only, local pickup in Montréal (delivery to Ottawa or Toronto may be possible.) Whatever doesn't sell is going on eBay where I can get slightly more than the prices I've listed, so these are NOT negotiable.
( Nikon D200, F100, lenses, free stuff, etc. ) |
|
|
| Teen Sleuth is back! |
[Sep. 29th, 2009|01:23 pm] |
If you missed it at fringe, or (like me) saw it at fringe and need to see it again, Teen Sleuth and the Freed Cyborg Choir is playing Wednesday -> Funday at MainLine Theatre.
I'm going on either Wednesday, Caturday, or Funday. Let me know if you want to join in! |
|
|
| Feline DNA sequence |
[Jul. 26th, 2009|03:55 pm] |
This is a long shot, but does anyone know where I can get a DNA sequence from a cat - any cat? I don't even need the whole thing - 100 base pairs should be enough. It's for an art project.
Update: Found!
tggtagaaggcaagctagctagccctgagtctcccctaccaaagctgtagctcagaagtcctatggctccagcaccaccaggtcccagctcttccctcaacggaggcctgcccaccacaccccaccatttccctctggccttcctcttgttctctttttgcacaaaactcaatttgcatcttgatggagatgaataattagaaccctctagcgtgaataattctaggcaaattaattttcatgccaatcagggaaaattaattggcttcatgatgtgtcaaattttccaggtggggctccccaggcttggctcccacctctgctgagcctggagcctcgggctctttcttccccagcactttggagaagattgcttgtttgttttattatttatttgtttattttcaatgcctccacagaccacaatgctacccttccttgcagctaaatgacccatttaacaatcatgataaaaacccccttagggccactactgacga
Yeah, it looks like any other DNA sequence from any other animal... but I'll know :) |
|
|
| I'm in your city killing your dudes |
[Jul. 24th, 2009|11:05 am] |
We've all seen ads on the web that change depending on where they think you are: "Hot Montreal girls that want to fuck you now" or even "Hot Stittsville girls." I've never even been to Stittsville. Maybe I should go - apparently the girls are just as attractive as the girls here, and probably more desperate.
I'm somehow less convinced by this ad though:
 |
|
|
| navigation |
| [ |
viewing |
| |
most recent entries |
] |
| [ |
go |
| |
earlier |
] |
| |
|
|
![[info]](http://l-stat.livejournal.com/img/userinfo.gif){kind=small}
scjody's journal